zfishbook
Connecting you to a world of zebrafish revertible mutants

Former candidate gene not linked to RFP pattern

A tagged insertion into GNT-arhgef7 494081
(http://www.ncbi.nlm.nih.gov/gene/?term=494081) was identiified in GBT0164 fish. However, linkage analysis PCR has shown that this insert doe not appear to be linked to the observed RFP pattern.

 

 


Genome Location: 1:46493473-46493481

Gene-P1 gnt_gbt0164_f1_arhgef7b: GGCTTTGTTGGAACTATTGGACG
Gene-P2 gnt_gbt0164_r1_arhgef7b: ACATGCTCATTACCACTGGAGAC  

Story Options

Trackback

Trackback URL for this entry: http://www.zfishbook.org/trackback.php?id=20150526135220822

No trackback comments for this entry.

0 comments

The following comments are owned by whomever posted them. This site is not responsible for what they say.

My Account





Sign up as a New User
Lost your password?

Line Jump

Jump to line (# only):

Grant Support