Former candidate gene not linked to RFP pattern

Tuesday, May 26 2015 @ 01:52 PM CDT

Contributed by: cldaby

A tagged insertion into GNT-arhgef7 494081
(http://www.ncbi.nlm.nih.gov/gene/?term=494081) was identiified in GBT0164 fish. However, linkage analysis PCR has shown that this insert doe not appear to be linked to the observed RFP pattern.

 

 

Genome Location: 1:46493473-46493481

Gene-P1 gnt_gbt0164_f1_arhgef7b: GGCTTTGTTGGAACTATTGGACG
Gene-P2 gnt_gbt0164_r1_arhgef7b: ACATGCTCATTACCACTGGAGAC  

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20150526135220822