zfishbook
Connecting you to a world of zebrafish revertible mutants

Former candidate gene not linked to RFP pattern

 A tagged insertion into GNT-LOC561772 (http://www.ncbi.nlm.nih.gov/gene/?term=561772) was identiified in GBT0254 fish. However, linkage analysis PCR has shown that this insert doe not appear to be linked to the observed RFP pattern. 


 http://zfin.org/action/marker/view/ZDB-GENE-041111-41

 
http://www.ensembl.org/id/ENSDART00000073397
 
Genome Location: 7:36,278,228-36,382,217
 
Gene P1: gnt_gbt0254_f1_nfatc3: GCCCTGTTGCACAATTTACCCTC
 
Gene P2: gnt_gbt0254_r1_nfatc3: TGGACAAACCAACGGGCAG

Story Options

Trackback

Trackback URL for this entry: http://www.zfishbook.org/trackback.php?id=20150616101739252

No trackback comments for this entry.

0 comments

The following comments are owned by whomever posted them. This site is not responsible for what they say.

My Account





Sign up as a New User
Lost your password?

Line Jump

Jump to line (# only):

Grant Support