Former candidate gene not linked to RFP pattern

Tuesday, June 16 2015 @ 10:17 AM CDT

Contributed by: cldaby

 A tagged insertion into GNT-LOC561772 (http://www.ncbi.nlm.nih.gov/gene/?term=561772) was identiified in GBT0254 fish. However, linkage analysis PCR has shown that this insert doe not appear to be linked to the observed RFP pattern. 

 http://zfin.org/action/marker/view/ZDB-GENE-041111-41

 
http://www.ensembl.org/id/ENSDART00000073397
 
Genome Location: 7:36,278,228-36,382,217
 
Gene P1: gnt_gbt0254_f1_nfatc3: GCCCTGTTGCACAATTTACCCTC
 
Gene P2: gnt_gbt0254_r1_nfatc3: TGGACAAACCAACGGGCAG

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20150616101739252