Former candidate gene not linked to RFP pattern

Thursday, June 18 2015 @ 08:56 AM CDT

Contributed by: cldaby

 A tagged insertion into GNT-si:ch73-290k24.5 101883316 (http://www.ncbi.nlm.nih.gov/gene/?term=101883316) was identiified in GBT0262 fish. However, linkage analysis PCR has shown that this insert doe not appear to be linked to the observed RFP pattern. 

 http://zfin.org/action/marker/view/ZDB-GENE-110411-284

 
http://www.ensembl.org/id/ENSDARG00000076310
 
Genome Location: 23:45962008-45962016
 
Insertion Location 3 Prime: GCATGAATAAACCTCGCTCACTTCCGGCCGGAGACGCCGTATTCCTTTTATAGCAGCTGGGGAATATCTCCTTTATTTTACACTCCTCGAGAAGAAGTCAGTTCCGCCCAGAACCGGGAGTGACGTCACAGGCGACGGCTCGACGAAATCCAGTTCAGAAGCGCGCCGCTCAGTGCAGGACAGCAGTGCCGACAGCAGCCGGGAGAACTGGTGGGTTTCTCTGACAGATGCATGAAAACTGTTATTCTCACACCTCGTGCTCACAGTGTCAGGCTGGAGCTGCATGCCTGTATCTGCATGGAGGGTTTACTGATTCAGCTTCATTCCGATGCGCGGCGAGCTGCTGTAGGTGTGACCTGATTTACACACGACCGAGCAGAAAGCGCTGCGTTATTATATTTCATCAGTGCATGTTTATTCTGGACTGTGTTTGCTCATGATGGTGGTGATGGAGCTTTATTCG
 
Insertion Location 5 Prime: GAATTTGCTTATTTATTTATTTTCCATTAGTTCTTTTGTCTGGACTCATTTCTAGATTTTGGTATCTTGCTTGAAATTCCTGTGCAAGATTGGGATAATTCTTTGATTTTGTCAAAATAAATTGCTGCGCATGGATTTTTTTGTTATGTGAGTCTCCATCTTGTGACAGGTGTGTTCTGTAGACAATCTTAAAGCGGCTAATAATATTGACCTAAAAATGGTGCTTAAAAAATTAAGAACTGCTTTTATTCTAGCCGAAATAAAACAAATCAGACTTTCTACAGAAGAACAAAAATATTATCAGACATACTGTGAACATTTCCTGAATCTGTTCAACATCATTTGGGAAATATTAGAAAAAAATAAATAAATCAAAGGGGGCGAATAATTCTGACTTCAACTGTAAATACACAGAAAAGGGAAAAATCGATGGCAATATATTAATTAAACTCTTAATTGGATTT

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20150618085640889