zfishbook
Connecting you to a world of zebrafish revertible mutants

Former candidate gene not linked to RFP pattern

A tagged insertion into GNT-insra 245699  (http://www.ncbi.nlm.nih.gov/gene/?term=245699) was identiified in GBT0278 fish. However, linkage analysis PCR has shown that this insert doe not appear to be linked to the observed RFP pattern. 


 http://zfin.org/ZDB-GENE-020503-3


http://www.ensembl.org/id/ENSDART00000008302
 
Genome Location: 2:37,265,784-37,353,729
 
Gene P1: gnt_gbt0278_f1_insra ACCTCTGTTCTTGCGGTCTTG
 
Gene P2: gnt_gbt0278_r1_insra TGTGGTCAGAGGTCCAATACTGC

Story Options

Trackback

Trackback URL for this entry: http://www.zfishbook.org/trackback.php?id=20150713154104817

No trackback comments for this entry.

0 comments

The following comments are owned by whomever posted them. This site is not responsible for what they say.

My Account





Sign up as a New User
Lost your password?

Line Jump

Jump to line (# only):

Grant Support