Former candidate gene not linked to RFP pattern

Monday, July 13 2015 @ 03:41 PM CDT

Contributed by: cldaby

A tagged insertion into GNT-insra 245699  (http://www.ncbi.nlm.nih.gov/gene/?term=245699) was identiified in GBT0278 fish. However, linkage analysis PCR has shown that this insert doe not appear to be linked to the observed RFP pattern. 

 http://zfin.org/ZDB-GENE-020503-3


http://www.ensembl.org/id/ENSDART00000008302
 
Genome Location: 2:37,265,784-37,353,729
 
Gene P1: gnt_gbt0278_f1_insra ACCTCTGTTCTTGCGGTCTTG
 
Gene P2: gnt_gbt0278_r1_insra TGTGGTCAGAGGTCCAATACTGC

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20150713154104817