Former candidate gene not linked to RFP pattern

Tuesday, July 14 2015 @ 03:01 PM CDT

Contributed by: cldaby

A tagged insertion into GNT-man1a1 566078  (http://www.ncbi.nlm.nih.gov/gene/?term=566078) was identiified in GBT0305 fish. However, linkage analysis PCR has shown that this insert doe not appear to be linked to the observed RFP pattern.  

 http://zfin.org/action/marker/view/ZDB-GENE-041014-321

 
http://www.ensembl.org/id/ENSDARG00000005652
 
Genome  Location: 20:41,052,785-41,274,369
 
Insertion Location 3 Prime: nih_extended_gbt0305_man1a1            TATAAAAAAAAGAGTAAACGGACAAAAGTTCTTCATATAGAACCAAAACTTTGACACATCTTTTGTTGTTACACATATGGAAAGATTTGAGCAGTGAGTCAACCTCAATCAGAAAATGCTGAAATATAGGGATTGAAGTCATGCTTTTTTGGTTATGTATAAAAAAAAAAGTCCAAACGAAATAAAAAAGTTGACAATAATTTATTTAGACTTATGTGCAGATGCTGAGTAATAACAAATATTTTTGTGCTGCCTTCTTTTATTATTATTAATGTCAAGGTAACAATAACATCATACAAATTTTGTTATGTAGATTGTACAAAAGTTTTACAGGGAAGTAAAGCATCAAATTAGCACAAACAAGAGAAAAAAAAATAAGTAAAAACAAACAACAAGTAATATAAAATCATTTTGTGATGAATAAGCAAAGAATGTTCAATCCAAAAGCATTGTGTATGAGGGCAATTCCAAAA
 
Insertion Location 5 Prime: nih_extended_gbt0305_man1a1           CAGCAGGATAGCACTCCTTCTCATACTTCAGCCTCCACATCAAAGTTCCTGAAAGCAAAGAAGGTTAAGGTGCTCCAGGATTGGCCAACCTAGTCACCAGAAATGAACATTATTGAGCATGTCTGGGGTAAGATGGAGGAGAAGGCCTTGAAGATGAATCTAAAGAACACACTGGGACTCATGCAAGAACTTTATATTCTATATTGTACATTATTGAGCTTTGTTCATCTTAACAAAGCTCAATAAATAGGGTTTTCGTATTATATTACAATGATGATACCTAATAGACTTCTGATCAAAGATGATTCGCATTGTGATATCGATGCTGAAACGCATTATTGTGCAGCCCTGACTTGAATATAGGTTGGCTTTCTTCTTTTTTGTCCTTGGCCAAAAACTTGCTCTCACATTGTTAGTGCTGAATAAGCATTATCAAAATCAATATAAAAACAAATTTAAACAAAATAGATTGCT

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20150714150137697