zfishbook
Connecting you to a world of zebrafish revertible mutants

Former candidate gene not linked to RFP pattern

 A tagged insertion into GNT-gsk3b 30654 (http://www.ncbi.nlm.nih.gov/gene/?term=30654) was identiified in GBT0317 fish. However, linkage analysis PCR has shown that this insert does not appear to be linked to the observed RFP pattern. 


 http://zfin.org/action/marker/view/ZDB-GENE-990714-4

 
http://useast.ensembl.org/Mus_musculus/Gene/Summary?g=ENSMUSG00000022812;r=16:38089001-38246084
 
Genome Location: 9:9,799,155-9,892,656
 
Insertion Location 3 Prime: NIH_extended_gbt0317_gsk3b           GTAGGAGGGATCCGGGGGTGAGAAGGGTGCACGACTTATTTGAGGACCGGGAGGGAGACGCGCAATTTCCGGGAGATTATCCCTCGTTTGCGGACATTATGAGTCCCACAAATGCATTGAGACTCCCGGAACTTCCAGGAGACTTGGGATGTCTGAATATCACATTTAACAACTGTAGTAAGAGGCGATCCAGCGGTACAACCTTGAAAAATGGTCCAACGTGCACTGCTCTCTGGAGCTCAGAGAAGCGCATGACAGTGTGTGGCTGTGTCTGTGTGTGTGTGGTCACTTGTGTTTTCAGATGACGGAGGGCTGACCTATAATACTATGTAAAACACGATGTGGATGTGAATCATTTTCATTCTAAAATGTCATTTTAATACTAAGAAGTATTAGTGTAAACGGGGCCTAAGTGTGTATTTTTCACAAGTTGGCTTGCGAAGGATCGGCGATGCTCGCTCAGCATCGTGTTGTC
 
Insertion Location 5 Prime: NIH_extended_gbt0317_gsk3b            CAAGGGCCAAACACAGACCATATCTGGGCCAAGTCTCAGCCAAGTTAATAATTCATAACTGGGCCTGAACTGGGCCAGAAAGGTTGGTGTGTCACGATTGCAATGAAATTAATAAACCTATGAAGCGTTGTGCTTTAGGCACACTATGGGCCTTGTTTTTTCTCAGTGACCTGATTGGTAGAATTAATTTATTTAATCCAAAATTATTTTTATGTATTTTAAATGTGGGTCAAGACTGGCCAAACTCACGTGGCCCACAATCAATTTTTAAAATCTGGGCCAAATACTACGTTTTACATCTGGCCCAAATCTTGTGTGCCGCATTATAGACGGTGCCACCTCTGCCAAACCCAGGCCATGGTTGGCCCACATGCTGTACGCCAGTGCCGAATGAATGCCTGATGTCCCAGCTTTATGCCAAATCTGGGCCAGAATTCTTTGCTACTAAGGCATTTATGTTGTGACAGTTTTGTG
 

Story Options

Trackback

Trackback URL for this entry: http://www.zfishbook.org/trackback.php?id=20150717091050221

No trackback comments for this entry.

0 comments

The following comments are owned by whomever posted them. This site is not responsible for what they say.

My Account





Sign up as a New User
Lost your password?

Line Jump

Jump to line (# only):

Grant Support