zfishbook
Connecting you to a world of zebrafish revertible mutants

Former candidate gene not linked to RFP pattern

A tagged insertion into GNT-tmeff1b 553511 (http://www.ncbi.nlm.nih.gov/gene/?term=553511) was identiified in GBT0327 fish. However, linkage analysis PCR has shown that this insert does not appear to be linked to the observed RFP pattern.  


 http://zfin.org/action/marker/view/ZDB-GENE-050706-143

 
http://www.ensembl.org/id/ENSDARG00000056740
 
Genome Location: 24:32,128,048-32,175,247
 
Insertion Location 3 Prime: nih_extended_gbt0336_tmeff1                    AATTGAGCGATTCCGTGCAACAAATTAGTAGCAATGCATACCTAAACAGCCCTTTCCTTTGCCGGACGCACAGTCGCTGTTCTGCGGGTAGGATGACTGGACGGATCCGCGTGCTGGGCTGATGATGGTGGTGGTGATGGTCAGCAAGCAGAACACACATAATAATAATTCTGCTCCAGTCCAGCTTACAAACCCTCTTCCCATCAGCATGATGTATGTTTATCTCCTCTTTGACCTGTTCAGTAAAGGCGCAGGCGAACAAAAGAGGAGCAGCGTGTGTATGATGCGGAAAATACTCCTTTCAAACCGTGTTTGTGTCCCGGGAAGGCCGACGGAGCCTTAAGAGCATCACTCCGGTGTTAAAAACAGCACATTAGCTCGGTTGTCCGCGAGCTCCAGCGCGTCTCAGTAAGCGCGCTCCGCCGATGATTCCTCGCGCTCCGGCTTTGTGTGCATCTCTGTCGC
 
Insertion Location 5 Prime: nih_extended_gbt0336_tmeff1                  GGCGCTTATGCAGGACAGCCACTGATTAAACCACTGGTGCCTGGAGCTTTGAATCTGAAAACACTGGCGCACAATGGCCACCATTGTCAGCTGCTTTTCCTTCTATTAATTCTAGGTGACAAAAAGGGTGTCAGGATTTTAAAAGGCAAGACAGCGAGAAGAGAAAAAGCCCATCTGGAGAGTTTACATTATATATAATGACCCAAAAGCCCGAGATGAGCATTGTGTTTAAAGGTTACATGTGAAACACTTGCTTATTTTGACATTTTCCACACAATTAATGCGTAAACAGTCATCAGGTGCAAGAGTAGTCTTAAAAAACCCAAAGAACCATTGACCTGCAAATGCTGCAAAGACAATCATTTAGATTTGGTTGGAGAAATCCATTATCCAATATATTAACCAATGAACACATTTCTAAAGGTCTACAAAGACACACAAGACAATAAATAACAGCACGCTTTCCA
 

Story Options

Trackback

Trackback URL for this entry: http://www.zfishbook.org/trackback.php?id=20150717091813295

No trackback comments for this entry.

0 comments

The following comments are owned by whomever posted them. This site is not responsible for what they say.

My Account





Sign up as a New User
Lost your password?

Line Jump

Jump to line (# only):

Grant Support