zfishbook
Connecting you to a world of zebrafish revertible mutants

Former candidate gene not linked to RFP pattern

 A tagged insertion into GNT-esrrb 407693 (http://www.ncbi.nlm.nih.gov/gene/?term=407693) was identiified in GBT0344 fish. However, linkage analysis PCR has shown that this insert does not appear to be linked to the observed RFP pattern.


 http://zfin.org/ZDB-GENE-040616-2

 
http://www.ensembl.org/id/ENSDARG00000040151
 
Genome Location: 17:52904807-52904815
 
Insertion Location 3 Prime: nih_extended_gbt0344_esrrb           TATGTGTCCATATGTCTGAAATATCCTGAAGCAGCAGTACTGTTTTGTACCGTCACATCGCGTGAGATTCCCGCTTTTTTAAGATAAATTTATATAACATTAATGAACATCAGTAAGTCGCCAGTAACTTATTTAATGTATGTTCCTGCAGGAAAAAATTGGAAATTCAAGAGTTCACACTTAGCTGATGATTGATTATAAGCAAGTTTGGCATGCCGTCCCGGGAGAGAGCCCTGAGCTCGAAGGTTCTTGAGCCCTGGGCTCCCTCCCGTTTGGAGGTAGAGAGGGGATCCTCGAGCTCAGGTAGATCTCGACAACTCCCCCTTTTTATAATAGCTAAAGATTAAGATTGAAGGCTATTAAAAGATCTGCTGCATTATTAGATTACCTGTATTGAAATTTAGATTTAACGATTAACTTGTTGTGCATGTTTTTGGAATGTGGGAGGAAACCGGAGAACCCGGGGAAAACCCAC
 
Insertion Location 5 Prime: nih-extended_gbt0344_esrrb           ACCGCGATGCAGACGCGGACAATTCAGTATCGGTTCAATAATAATCATAACCGGTTATTATGCACTGACGTCATTGATCTCCTATGCGCTCTGTCGCGAGGGAGGTGAGCGCGAGTATTTACAACACTCAGCCAACTCAGGGCCGGCCCGTGGCATAGGCATCATAGGCAAAAGCTTAGGGCGCTGTATATCCAGGGGGGCGCCAGAAATGAGCGCGCTTCAGATGGTTTTGTTTTCGATATTCCTGACACACATTCAGTGATAGACGGCAATAACTCAAAAACCTCTTACCCTAAAAAGATCTAAAGTGTGTTTCCTACAAAAAGACAAAGCTGGTTGTGTTTCACAGCTGTCTTTCTTTCTTTTTTTTTTGCTCGACATTACCAGCACTGCTCCGTTTAAGCCCTCGCAATATGTGTTTAGCCGGGAGAGCTTGCGCTGAGTAAGGGACCGTCGGAAAAGTGCTTCTGTTTTT

Story Options

Trackback

Trackback URL for this entry: http://www.zfishbook.org/trackback.php?id=20150723105503948

No trackback comments for this entry.

0 comments

The following comments are owned by whomever posted them. This site is not responsible for what they say.

My Account





Sign up as a New User
Lost your password?

Line Jump

Jump to line (# only):

Grant Support