Former candidate gene not linked to RFP pattern

Thursday, July 23 2015 @ 10:55 AM CDT

Contributed by: cldaby

 A tagged insertion into GNT-esrrb 407693 (http://www.ncbi.nlm.nih.gov/gene/?term=407693) was identiified in GBT0344 fish. However, linkage analysis PCR has shown that this insert does not appear to be linked to the observed RFP pattern.

 http://zfin.org/ZDB-GENE-040616-2

 
http://www.ensembl.org/id/ENSDARG00000040151
 
Genome Location: 17:52904807-52904815
 
Insertion Location 3 Prime: nih_extended_gbt0344_esrrb           TATGTGTCCATATGTCTGAAATATCCTGAAGCAGCAGTACTGTTTTGTACCGTCACATCGCGTGAGATTCCCGCTTTTTTAAGATAAATTTATATAACATTAATGAACATCAGTAAGTCGCCAGTAACTTATTTAATGTATGTTCCTGCAGGAAAAAATTGGAAATTCAAGAGTTCACACTTAGCTGATGATTGATTATAAGCAAGTTTGGCATGCCGTCCCGGGAGAGAGCCCTGAGCTCGAAGGTTCTTGAGCCCTGGGCTCCCTCCCGTTTGGAGGTAGAGAGGGGATCCTCGAGCTCAGGTAGATCTCGACAACTCCCCCTTTTTATAATAGCTAAAGATTAAGATTGAAGGCTATTAAAAGATCTGCTGCATTATTAGATTACCTGTATTGAAATTTAGATTTAACGATTAACTTGTTGTGCATGTTTTTGGAATGTGGGAGGAAACCGGAGAACCCGGGGAAAACCCAC
 
Insertion Location 5 Prime: nih-extended_gbt0344_esrrb           ACCGCGATGCAGACGCGGACAATTCAGTATCGGTTCAATAATAATCATAACCGGTTATTATGCACTGACGTCATTGATCTCCTATGCGCTCTGTCGCGAGGGAGGTGAGCGCGAGTATTTACAACACTCAGCCAACTCAGGGCCGGCCCGTGGCATAGGCATCATAGGCAAAAGCTTAGGGCGCTGTATATCCAGGGGGGCGCCAGAAATGAGCGCGCTTCAGATGGTTTTGTTTTCGATATTCCTGACACACATTCAGTGATAGACGGCAATAACTCAAAAACCTCTTACCCTAAAAAGATCTAAAGTGTGTTTCCTACAAAAAGACAAAGCTGGTTGTGTTTCACAGCTGTCTTTCTTTCTTTTTTTTTTGCTCGACATTACCAGCACTGCTCCGTTTAAGCCCTCGCAATATGTGTTTAGCCGGGAGAGCTTGCGCTGAGTAAGGGACCGTCGGAAAAGTGCTTCTGTTTTT

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20150723105503948