zfishbook
Connecting you to a world of zebrafish revertible mutants

Former candidate gene not linked to RFP pattern

A tagged insertion into GNT-tefm 566236 (http://www.ncbi.nlm.nih.gov/gene/?term=566236) was identiified in GBT0360 fish. However, linkage analysis PCR has shown that this insert does not appear to be linked to the observed RFP pattern. 


 http://zfin.org/action/marker/view/ZDB-GENE-060825-345

 
http://www.ensembl.org/id/ENSDART00000082693
 
Genome Location: 6:19351829-19351837
 
Gene P1: GNT_GBT0360_f1_tefm AATCCTACAATCATGGAGCCAAACG
 
Gene P2: GNT_GBT0360_r1_tefm ACCCGTATCCTGCACAGACC

Story Options

Trackback

Trackback URL for this entry: http://www.zfishbook.org/trackback.php?id=20150727140606713

No trackback comments for this entry.

0 comments

The following comments are owned by whomever posted them. This site is not responsible for what they say.

My Account





Sign up as a New User
Lost your password?

Line Jump

Jump to line (# only):

Grant Support