zfishbook
Connecting you to a world of zebrafish revertible mutants

Former candidate gene not linked to RFP pattern

A tagged insertion into GNT-cald1b 563892 (http://www.ncbi.nlm.nih.gov/gene/?term=563892) was identiified in GBT0367 fish. However, linkage analysis PCR has shown that this insert does not appear to be linked to the observed RFP pattern.   


http://zfin.org/ZDB-GENE-090313-229

 
http://www.ensembl.org/id/ENSDARG00000086391
 
Genome Location: 25:20692381-20692389
 
Insertion Location 3 Prime: nih_extended_gbt0367_cald1        CTGTAGCAAAACCATGGTAAATATGTGGCTACCATGGTTTTAGCAACAATAAACATTGTTTTTATTTGTAGTTAAACCATACTTATTTTTAGTAGTATTATTATACCGGTGTGTCAAAACATCGCATACTTCCCTATGTAGTAAATAAGCCGATTAGTGTGTAAGAATTCATAGTATTTGAAAAAAGTAGACGAGAAGCGCACCCAATTCGAATGTAACCATTTGATTGTATGGGTGTTATCAGTGGATATCAGCTGATAGATATGGGCAAGTAGGGGCTAGTAGGGGCTAGTAGGTGCAGAAGGCCCCTACCGGCCCAAATCTAAGCTGTTAACCACTGATAACGGCCATACAATCGGGTGATAACAAATAAATCGGCAGCAAGAAGTAGCTGGATGAGCTCCATTGAGATTCTGAATGTGCATCCAATCGACACTTTACTATCCCATAAGGCCACAGGTGAGAATTTATGAATATG
 

Insertion Location 5 Prime: nih_extended_gbt0367_cald1           AATTTGTCCCAGGCTTTACAAATCAAACAGTGGGCTGGTCTCCAAACAGCTCTTTCATCTTGAAGGGTCTGTATGATTTCAGTGGTTAATTAATTATAGTATTTGACATAATGTAGGTTGCACATTGGTTCATCAACACACCTGTTTCCCATTATCCCTTTCCCAGACACTGTTACCAAAATCATTAGAGTGCTCACGTATGTTCTGTTCTAATGTCCCCCCAAAAATGCCTATTTCATCTTTATACAGCCCTGGAATAATTAAGAGAACACTTACGTATCTGGATATATGTTTTTCTTATTCAGTGTGTATTGTCTGAAAACAGCATATTTTATTTTGACTTACTGTCCTTTTCTGCAAATAAATGATCTAAATTATAATATTTTATATTTTGAATTCATATTTTCATTGTTTATTAAATAAACCACAGTTGAATCAGGTTGAAAAGACTCACTCTTACAGTGTGTTTCTTTGT 

Story Options

Trackback

Trackback URL for this entry: http://www.zfishbook.org/trackback.php?id=20150727141045100

No trackback comments for this entry.

0 comments

The following comments are owned by whomever posted them. This site is not responsible for what they say.

My Account





Sign up as a New User
Lost your password?

Line Jump

Jump to line (# only):

Grant Support