Former candidate gene not linked to RFP pattern

Monday, July 27 2015 @ 02:10 PM CDT

Contributed by: cldaby

A tagged insertion into GNT-cald1b 563892 (http://www.ncbi.nlm.nih.gov/gene/?term=563892) was identiified in GBT0367 fish. However, linkage analysis PCR has shown that this insert does not appear to be linked to the observed RFP pattern.   

http://zfin.org/ZDB-GENE-090313-229

 
http://www.ensembl.org/id/ENSDARG00000086391
 
Genome Location: 25:20692381-20692389
 
Insertion Location 3 Prime: nih_extended_gbt0367_cald1        CTGTAGCAAAACCATGGTAAATATGTGGCTACCATGGTTTTAGCAACAATAAACATTGTTTTTATTTGTAGTTAAACCATACTTATTTTTAGTAGTATTATTATACCGGTGTGTCAAAACATCGCATACTTCCCTATGTAGTAAATAAGCCGATTAGTGTGTAAGAATTCATAGTATTTGAAAAAAGTAGACGAGAAGCGCACCCAATTCGAATGTAACCATTTGATTGTATGGGTGTTATCAGTGGATATCAGCTGATAGATATGGGCAAGTAGGGGCTAGTAGGGGCTAGTAGGTGCAGAAGGCCCCTACCGGCCCAAATCTAAGCTGTTAACCACTGATAACGGCCATACAATCGGGTGATAACAAATAAATCGGCAGCAAGAAGTAGCTGGATGAGCTCCATTGAGATTCTGAATGTGCATCCAATCGACACTTTACTATCCCATAAGGCCACAGGTGAGAATTTATGAATATG
 

Insertion Location 5 Prime: nih_extended_gbt0367_cald1           AATTTGTCCCAGGCTTTACAAATCAAACAGTGGGCTGGTCTCCAAACAGCTCTTTCATCTTGAAGGGTCTGTATGATTTCAGTGGTTAATTAATTATAGTATTTGACATAATGTAGGTTGCACATTGGTTCATCAACACACCTGTTTCCCATTATCCCTTTCCCAGACACTGTTACCAAAATCATTAGAGTGCTCACGTATGTTCTGTTCTAATGTCCCCCCAAAAATGCCTATTTCATCTTTATACAGCCCTGGAATAATTAAGAGAACACTTACGTATCTGGATATATGTTTTTCTTATTCAGTGTGTATTGTCTGAAAACAGCATATTTTATTTTGACTTACTGTCCTTTTCTGCAAATAAATGATCTAAATTATAATATTTTATATTTTGAATTCATATTTTCATTGTTTATTAAATAAACCACAGTTGAATCAGGTTGAAAAGACTCACTCTTACAGTGTGTTTCTTTGT 

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20150727141045100