Former candidate gene not linked to RFP pattern

Wednesday, September 02 2015 @ 12:52 PM CDT

Contributed by: cldaby

A tagged insertion into GNT-gyg1a
 406831 (http://www.ncbi.nlm.nih.gov/gene/?term=406831) was identiified in GBT0583 fish. However, linkage analysis PCR has shown that this insert does not appear to be linked to the observed RFP pattern.  

 

 

http://zfin.org/action/marker/view/ZDB-GENE-040426-2910

 
http://www.ensembl.org/id/ENSDART00000025962
 
Genome Location: 2:24706774-24706782
 
Gene P1 Sequence: GNT_GBT0583_f1_gyg1a CACGTCCACTTTCTCTCCCAGC
 

Gene P2 Sequence: GNT_GBT0583_r1_gyg1a ACAGCTATACCAAACAATGAAGCAC 

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20150902125255736