Former candidate gene not linked to RFP pattern

Wednesday, September 02 2015 @ 12:59 PM CDT

Contributed by: cldaby

A tagged insertion into GNT-ncam2
 114441 (http://www.ncbi.nlm.nih.gov/gene/?term=114441) was identiified in GBT0714 fish. However, linkage analysis PCR has shown that this insert does not appear to be linked to the observed RFP pattern.  

 

 

http://zfin.org/action/marker/view/ZDB-GENE-010822-1

 
http://www.ensembl.org/id/ENSDART00000100681
 
Genome Location: 9:36606510-36606518
 
Gene P1 Sequence: GNT_GBT0714_f1_ncam2 TTCAGCTCAGCAGTCAGTCTTACC
 

Gene P2 Sequence: GNT_GBT0714_r1_ncam2 GTTCCAACCCAAAGTAAACACACC 

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20150902125950822