zfishbook
Connecting you to a world of zebrafish revertible mutants

Former candidate gene not linked to RFP pattern

A tagged insertion into GNT-taf6l
 557363 (http://www.ncbi.nlm.nih.gov/gene/?term=557363) was identiified in GBT0718 fish. However, linkage analysis PCR has shown that this insert does not appear to be linked to the observed RFP pattern.  

 

 


http://www.ensembl.org/id/ENSDART00000113120

 
Genome Location: 7:19210197-19210205
 
Gene P1 Sequence: GNT_GBT0718_&_717_f1_taf6l TGATGCGATTTCACAGGTCAGAG 
 

Gene P2 Sequence: GNT_GBT0718_&_717_r1_taf6l CATGCGAATGCAGCAGACC  

Story Options

Trackback

Trackback URL for this entry: http://www.zfishbook.org/trackback.php?id=20150902130359560

No trackback comments for this entry.

0 comments

The following comments are owned by whomever posted them. This site is not responsible for what they say.

My Account





Sign up as a New User
Lost your password?

Line Jump

Jump to line (# only):

Grant Support