Former candidate gene not linked to RFP pattern

Wednesday, September 02 2015 @ 01:03 PM CDT

Contributed by: cldaby

A tagged insertion into GNT-taf6l
 557363 (http://www.ncbi.nlm.nih.gov/gene/?term=557363) was identiified in GBT0718 fish. However, linkage analysis PCR has shown that this insert does not appear to be linked to the observed RFP pattern.  

 

 

http://www.ensembl.org/id/ENSDART00000113120

 
Genome Location: 7:19210197-19210205
 
Gene P1 Sequence: GNT_GBT0718_&_717_f1_taf6l TGATGCGATTTCACAGGTCAGAG 
 

Gene P2 Sequence: GNT_GBT0718_&_717_r1_taf6l CATGCGAATGCAGCAGACC  

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20150902130359560