zfishbook
Connecting you to a world of zebrafish revertible mutants

ASQ Primer (mtfmt_5del)

These primers have not been ordered, and have not been confirmed. These are their sequences and names. 


 Designed Primers 

MTFMT_Wt-5bp_F_Fam AATGGCTTCCGAGACCTGCTGTCGAAGAACTGCACTGCTGAAGAG

 

MTFMT_Wt-5bp_F_Hex CGACAGAACACGCTCCAGCATTGGAAGAACTGCACTGCTGAAGAG

 

MTFMT_Wt-5bp_R_Fam AATGGCTTCCGAGACCTGCTGTCCCAAAGTAGCTCCGAGCTCT

 

MTFMT_Wt-5bp_R_Hex CGACAGAACACGCTCCAGCATTGCCAAAGTAGCTCCGAGCTCT

 

MTFMT_Mut-5bp-F_Hex CGACAGAACACGCTCCAGCATTGGAAGAACTGCACTGCTGCTCGG

 

MTFMT_Mut-5bp-F_Fam AATGGCTTCCGAGACCTGCTGTCGAAGAACTGCACTGCTGCTCGG

 

MTFMT_Mut-5bp-R_Hex CGACAGAACACGCTCCAGCATTGCCAAAGTAGCTCCGAGCAGC

 

MTFMT_Mut-5bp-R_Fam AATGGCTTCCGAGACCTGCTGTCCCAAAGTAGCTCCGAGCAGC

 

Story Options

Trackback

Trackback URL for this entry: http://www.zfishbook.org/trackback.php?id=20170616140945440

No trackback comments for this entry.

0 comments

The following comments are owned by whomever posted them. This site is not responsible for what they say.

My Account





Sign up as a New User
Lost your password?

Line Jump

Jump to line (# only):

Grant Support