ASQ Primer (mtfmt_5del)

Tuesday, November 30 1999 @ 02:09 PM CST

Contributed by: alexcook

These primers have not been ordered, and have not been confirmed. These are their sequences and names. 

 Designed Primers 

MTFMT_Wt-5bp_F_Fam AATGGCTTCCGAGACCTGCTGTCGAAGAACTGCACTGCTGAAGAG

 

MTFMT_Wt-5bp_F_Hex CGACAGAACACGCTCCAGCATTGGAAGAACTGCACTGCTGAAGAG

 

MTFMT_Wt-5bp_R_Fam AATGGCTTCCGAGACCTGCTGTCCCAAAGTAGCTCCGAGCTCT

 

MTFMT_Wt-5bp_R_Hex CGACAGAACACGCTCCAGCATTGCCAAAGTAGCTCCGAGCTCT

 

MTFMT_Mut-5bp-F_Hex CGACAGAACACGCTCCAGCATTGGAAGAACTGCACTGCTGCTCGG

 

MTFMT_Mut-5bp-F_Fam AATGGCTTCCGAGACCTGCTGTCGAAGAACTGCACTGCTGCTCGG

 

MTFMT_Mut-5bp-R_Hex CGACAGAACACGCTCCAGCATTGCCAAAGTAGCTCCGAGCAGC

 

MTFMT_Mut-5bp-R_Fam AATGGCTTCCGAGACCTGCTGTCCCAAAGTAGCTCCGAGCAGC

 

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20170616140945440