zfishbook
Connecting you to a world of zebrafish revertible mutants

ASQ Primer (smdt1_3ins)

Do not have these primers, and they are not confirmed. These are their sequences and names. 


 Designed Primers

SMDT1_Wt-3bp_F_Fam AATGGCTTCCGAGACCTGCTGTCCGGTCGGTGTGTTCTCCT

 

SMDT1_Wt-3bp_F_Hex CGACAGAACACGCTCCAGCATTGCGGTCGGTGTGTTCTCCT

 

SMDT1_Wt-3bp_R_Fam AATGGCTTCCGAGACCTGCTGTCCTGAAGCCCGAGCTGAGG

 

SMDT1_Wt-3bp_R_Hex CGACAGAACACGCTCCAGCATTGCTGAAGCCCGAGCTGAGG

 

SMDT1_Mut-3bp-F_Hex CGACAGAACACGCTCCAGCATTGCGGTCGGTGTGTTCTCGG

 

SMDT1_Mut-3bp-F_Fam AATGGCTTCCGAGACCTGCTGTCCGGTCGGTGTGTTCTCGG

 

SMDT1_Mut-3bp-R_Hex CGACAGAACACGCTCCAGCATTGCTGAAGCCCGAGCTGGAC

 

SMDT1_Mut-3bp-R_Fam AATGGCTTCCGAGACCTGCTGTCCTGAAGCCCGAGCTGGAC

 

Story Options

Trackback

Trackback URL for this entry: http://www.zfishbook.org/trackback.php?id=20170616154801508

No trackback comments for this entry.

0 comments

The following comments are owned by whomever posted them. This site is not responsible for what they say.

My Account





Sign up as a New User
Lost your password?

Line Jump

Jump to line (# only):

Grant Support