ASQ Primer (smdt1_3ins)

Tuesday, November 30 1999 @ 03:48 PM CST

Contributed by: alexcook

Do not have these primers, and they are not confirmed. These are their sequences and names. 

 Designed Primers

SMDT1_Wt-3bp_F_Fam AATGGCTTCCGAGACCTGCTGTCCGGTCGGTGTGTTCTCCT

 

SMDT1_Wt-3bp_F_Hex CGACAGAACACGCTCCAGCATTGCGGTCGGTGTGTTCTCCT

 

SMDT1_Wt-3bp_R_Fam AATGGCTTCCGAGACCTGCTGTCCTGAAGCCCGAGCTGAGG

 

SMDT1_Wt-3bp_R_Hex CGACAGAACACGCTCCAGCATTGCTGAAGCCCGAGCTGAGG

 

SMDT1_Mut-3bp-F_Hex CGACAGAACACGCTCCAGCATTGCGGTCGGTGTGTTCTCGG

 

SMDT1_Mut-3bp-F_Fam AATGGCTTCCGAGACCTGCTGTCCGGTCGGTGTGTTCTCGG

 

SMDT1_Mut-3bp-R_Hex CGACAGAACACGCTCCAGCATTGCTGAAGCCCGAGCTGGAC

 

SMDT1_Mut-3bp-R_Fam AATGGCTTCCGAGACCTGCTGTCCTGAAGCCCGAGCTGGAC

 

Comments (0)


zfishbook
http://www.zfishbook.org/article.php?story=20170616154801508